Sentence examples for based on published target from inspiring English sources

Exact(1)

These financial plans are linked to a macroeconomic projection based on published target values for various economic indicators.

Similar(59)

A 21 nucleotide sequence (5' TTGCGTTATACTTCTGTTTTA 3') specific to PCN and its paralog, Pt-ATHB.11 (Phytozome Populus v2.0 gene model POPTR_0003s04860; Joint Genome Institute Populus v1.1 gene model estExt_fgenesh4_pg.C_LG_III0436) was targeted based on published targeting parameters [62], [63], [64] and uniqueness to PCN and its paralog, Pt-ATHB.11.

fThese cut-offs were selected based on published policy/strategy targets associated with the third dose of Diphtheria-Tetanus-Pertussis (DTP3): The GAVI eligibility policy permits countries to apply for most of the routine new/underutilized vaccines so long as they have DTP3 coverage equal to, or greater than 70% [ 61].

He said Amgen had already dropped some targets based on published findings from deCODE.

An international expert panel has been convened to develop 'treat-to-target' recommendations, based on published evidence and expert opinion.

The majority of targets was selected based on published data [ 5, 6, 45]; for more detailed description see Supplementary materials and methods (Additional file 1).

Healthcare costs based on published hospital costs.

The loperamide dose was selected based on published data.

Based on published reports, Woods found married life unfulfilling.

This classification was based on published studies [11], [28], [29].

We assigned species to trophic groups based on published literature.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: