The size of the PCR products obtained (1000 bp) was the expected size for the gene regions examined based on genome sequence data [ 20] (data not shown).
Methods for reconstructing trees based on genome rearrangement data include distance-based methods (for example, neighbor-joining [ 18]), maximum parsimony methods based on encodings [ 19, 20], and direct optimization methods.
The phylogenetic inferences based on genome arrangement data rendered inconclusive results.
There are two papers that conducted gene association studies based on genome wide data.
Both Parsimony [ 8] and Bayesian [ 9, 10] methods are available to reconstruct phylogenies based on genome arrangement data.
Phylogenetic relationships among gastropods were also reconstructed based on genome arrangement data using parsimony and Bayesian inferences with the GRAPPA [ 8] and Badger [ 94] programs.
For example, it has been proposed that, based on genome sequence data, many attractive and so far unknown flavoproteins can still be obtained from nature [ 3].
Forward and reverse primers for PCR amplifications Cb-egl-5, CAGGGAGCGGACAACTTCAAAGG and GGACACAGCCCAGGATTAGCGAC, respectively, were designed based on genome sequence data from C. briggsae strain AF16 [ 41].
First, a set of high confidence variants was called for each mutant with VarScan (Koboldt et al. 2012, 2009) based on genome sequencing data from the mapping strain and genomes of the segregant bulks, with reads from both bulks merged.
However, disentangling selection from nuisance signals caused by the demographic history of a breed or species based on genome wide polymorphism data remains challenging.
