Sentence examples for based on consistent expression from inspiring English sources

Based on consistent expression level in the different samples, the cacao tubulin1 (Tc06g000360000360) gene was used as a control and used to normalize expression data (TUB1-5′: GGandAGTCTCTATACATAAGCATAGCCAGCTAGAGCCAG: ACATAAGCATAGCCAGCTAGAGCCAG).

Based on consistent Cyclophilin A gene expression throughout the biological replicates, this gene was used to normalize the expression data.

Genes identified by BAM as having significantly changed expression were then further selected based on consistent and appropriate present and absent calls per Affymetrix software.

Transcript expression levels were normalized using the control gene Actin-related protein 2/3 complex 3 (arpc3) which was selected from the RNA-seq data set based on its consistent expression between Hayle and Teign fish in all tissues (Supporting Information Table S3a).

Based on the consistent expression pattern in repeated experiments of in vitro and in vivo derived oocytes, it is plausible to speculate that these two genes (LUM and STC1) may be potential molecular markers of oocyte maturation and may contribute to the early events of embryo development.

HPRT1 was selected based on its consistent moderate expression in our sample sets in prior microarray and RT-qPCR analysis (see Additional file 1 and reference [ 32]) and its previous use as a canine reference gene [ 36].

From their observations the authors conclude that cell line groupings based on miRNA expression are generally consistent with tissue type and with cell line clustering based on mRNA expression, although mRNA expression seems to be more informative.

Our results, based on gene expression profiling, are consistent with the existence of two sub-types of retinoblastoma, group 1 retinoblastomas that show features of multiple retinal cell types, and group 2 retinoblastomas that show a distinctive cone photoreceptor expression profile.

This result was consistent with previous studies based on gene expression profiling.

This relative heterogeneity of ER + tumors is consistent with previous classification based on gene expression [ 12, 26].

In each case, the relationship between baseline expression level and mean lifespan was consistent with that expected based on differential expression patterns in dwarf models and under CR (compare Fig. 8 to Fig. 9).