Sentence examples for based on conserved regions from inspiring English sources

Exact(42)

Partial sequences of the cestode nad1 gene were aligned and new primers were designed based on conserved regions.

We designed a degenerate primer set (P5CS-Deg-F: 5′-GGNATHTTYTGGGAYAAYGA-3′; P5CS-Deg-R: 5′-GTYTCCATNGCRTTRCANGC-3′) based on conserved regions for plant P5CS enzymes.

We selected 3 short interfering RNA (siRNA) sequences (siVP1618, siVP11115, and siVP12571) based on conserved regions in the vp1 gene of the infectious bursal disease virus (IBDV).

For this, a specific primer pair based on conserved regions of enterotoxin genes was designed for detecting most of the described staphylococcal enterotoxins.

Based on conserved regions of NRAMP1 and NRAMP3 in other plants, we designed primers and cloned MxNRAMP1 and MxNRAMP3 genes from M. xiaojinensis, the functions of which were preliminarily characterized in yeast, a eukaryotic model organism.

In this study, we have cloned four partial CDPK cDNAs (CsCDPK1 4) from cucumber by reverse transcription polymerase chain reaction (RT-PCR) using degenerate oligonucleotide primers designed based on conserved regions of the other known CDPKs.

Show more...

Similar(18)

Specific primers based on conserved region of Leishmania 18S ribosomal DNA gene were disigned by using ABI FileBuilder 3.1 and consisted of; forward 5′- CCGTTTCGGCTTTTGTTGGTTTTAA; GCGATGGGAAAGCACTTGTC-3′; and reporter: CAGCTCCATAATCTCC Applied Biosystems Inc.., Foster City, CA).

For the subfamilies CYP2C and CYP2D primers were designed based on conserved gene regions, thus enabling amplification of all isoenzymes belonging to these subfamilies.

Though signatures are generally based on conserved gene regions, they often fail to take into account all of the variation within a target set of organisms.

PAR-2, which is activated by trypsin, was identified by screening a mouse genomic library for GPCRs with oligos based on conserved transmembrane regions of the bovine substance K receptor [ 27].

Because the ninespine stickleback spiggin genes were published as partial sequences, we concatenated them based on conserved domain region information.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: