Sentence examples for based on a template developed from inspiring English sources
The informed assent form was based on a template developed by the Washington University IRB and was specifically designed for use with pediatric populations.
A software application has been developed for OPTIGOV based on a template from Microsoft Office products, to allow an easy interface with them.
The law set a mandatory minimum of twenty-five years on the registry — based on a template that was spreading across the country.
Based on a standard template, wiki users will be able to add reports of voter suppression to the wiki.
These student perceptions were collected as narrative documents based on a suggested template.
It consisted in analyzing educational/pedagogical subjects in MOOCs that were being developed in Spanish based on an analysis template designed by the research team.
Provincial Finance and Planning departments' involvement in developing provincial PC 1s were described by two participants as "(A) 2 3 day negotiation process", with limited consideration to individual program capacities and needs as the PC1s were based on federally developed templates.
The IAC qPCR was developed based on a 105 base template derived from the jellyfish aequorin gene which has a sequence of 5'- GCCTGGTGCAAAAATTGCTTATCAAATTGAACGGTCAATTGGAAGTGGCGGAAGAACAGCTATTGCAAACGC CATCGCACAATACCATAAACACACTTGTCTTAG-3' [ 24].
Lampreys are a primitive fish that branched off from other vertebrates (animals with a backbone, like you) 550 million years ago and developed their own system of antibody recognition based on a completely different template.
Most of the treaties are based on a standard OECD template which has hardly been updated in almost a century.
