Your English writing platform
Discover LudwigExact(1)
Several amounts of amine and sulfonyl groups were introduced into the PSU chemical structure in order to create interactions with acid or base templates, such as biomolecules or biomacromolecules.
Similar(59)
An industry standard method of quantifying roof support is adopted as a base template (GRSUP).
Using customizable design templates sourced from professionals, online shoppers will be able to use intuitive web software to quickly adjust a base template to their liking then have it printed via Shapeways.
The static region's base "template", however, will not be accessible to the end user and must be provided for and maintained by the data centre host.
I can take a copy of an existing pipe (application, argggh) and use it as a base template for my own pipe and I can browse an existing library of pipes.
The IAC qPCR was developed based on a 105 base template derived from the jellyfish aequorin gene which has a sequence of 5'- GCCTGGTGCAAAAATTGCTTATCAAATTGAACGGTCAATTGGAAGTGGCGGAAGAACAGCTATTGCAAACGC CATCGCACAATACCATAAACACACTTGTCTTAG-3' [ 24].
NMR structures of HIV-1 TAR RNA obtained by Davidson et al. retrieved from the Brookhaven PDB (PDB ID 2L8H) were used as a base template.
Libraries were amplified and enriched using the Ion OneTouch™ 100 or 200 base template kit (Life Technologies) according to the manufacturer's standard protocol.
Gene specific primers were as follows: F1, ATGGAGAAAGCAGACGACGCTATGC; F2, CTACCAAGACAGTTTTGTGG; R1, CTACATCAATTGCTGTGGTTGCATGG and R2, ACTTTGACTTCTTTGACTCG. Primers F2 and R1 were used to generate a 776 base template for a riboprobe synthesis.
Trace the base template onto cardboard with a pen or pencil.
A model is proposed to elucidate the stabilization process of the amphiphilic PEG-PLA aggregated architecture on the water droplet-based templates.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com