Sentence examples for base reference from inspiring English sources

The base reference frame is located at skin level on the ulnar side of the palm.

A base reference frame is located on the carpometacarpal joint of the thumb.

These include one base reference, only alloyed with C (Base steel) and two alloyed also with 1 mass% Si or Cr.

Based on hypothesis testing and multiple comparisons analyzed to obtain the graphics of the five signs, the conclusions provide a base reference for graphic design of highway variable message signs.

Our version of a three stage SVC type rectifier/charge-pump, Figure 13, also uses the conventional NMOS as the base reference, and it was optimized for medical RF wireless band.

In this presented research legacy data was used to derive centroid values for World Reference Base Reference Soil Groups based on the Global Soil Map project defined soil properties in the specified depth intervals and test the applicability of numerical approaches for classifying soils, based on these specifications.

For GAPDH primers (forward: ATGGCGAAGATTAAGATCGGGAT, reverse: CACAGTGTCATACTTGAACA) were designed based reference gene sequence [Genebank:GQ848049].

In the proposed architecture, a DFNN- dynamic-fuzzy-neural-network-) baseDFNN- dynamic-fuzzy-neural-network-loyeDFNN- dynamic-fuzzy-neural-network-

Three-dimensional joint rotations and planar angles were calculated according to anatomically based reference frames.

In addition, the kit contains relevant scientifically based reference reports on hand ergonomics.

In this paper we introduce our ontology based reference model approach to solve this problem.