Sentence examples for bar probe from inspiring English sources

The effects of the superficial gas velocity (up to 0.30 m/s), pressure (up to 10 bar), probe position, and probe orientation were investigated.

Genomic DNA was digested with HindIII, resolved by electrophoresis and hybridized with DIG labeled bar probe.

2 37 Outside bar, Probe laughs at Dave's sandals.

2 37 (picture 1 | 2) Outside bar, Probe laughs at Dave's sandals.

In these experiments the padlock probes showed the same sensitivity, except for the bar probe that showed a slightly lower sensitivity (0.5% instead of 0.1%) when all 'negative' samples were included in the analysis.

A digoxin (DIG -labeled bar probe was synthesizeDIG -labeleded with DIG-High Prime DNA Labaring and Detection Starter Kit I (Roche Aprobed Science, Indianapolis, IN, USA) according to the manufacturer's instructions.

Primer and probe sequences are listed here: Bar-F: ggccgagtcgaccgtgta; Bar-R: ttgggcagcccgatga; Bar-Probe: FAM-cgccaccagcggacggga-TAMRA; AtCO-F: gtccgggtctgcgagtca; AtCO-R: gctgtgcatagagaggcatcatc; AtCO-Probe: VIC-tgctccggctgcttttttgtgtgag-TAMRA.

Blue bars = "probe" genes, black bars = new genes, red triangles = transposable elements.

Following a blank 500 ms duration after the last test bar, a probe bar of the same colour as one of the test bars appeared.

Five hundred milliseconds after the presentation of the bar, a probe bar of the same colour surrounded by a black circle appeared below the target bar.

(b) Left: restriction enzyme maps of the AaargB loci in the MR12 strain and its transformants with the AaargB disruption cassette 2. The DNA probes used for Southern blot analysis are indicated with a double line (5'-probe) and a solid bar (3'-probe).