Sentence examples for band was produced using from inspiring English sources

Exact(1)

An identical band was produced using RNA from the androgen sensitive prostate cancer cell line LNCAP, (not shown).

Similar(59)

Spectrograms were produced using the broad-band (323 Hz) filter settings, and applying a flat top window, frame size 54%, overlap 87.5% and a Fast Fourier transformation of 1024.

Zinc metal is produced using extractive metallurgy.

All maps were produced using ArcMap 9.3.1 [51].

A 750 bp control band was produced by amplification from the endogenous PrP gene using PrP-S and the reverse primer (PrP-AS: 5' CCTCTTTGTGACTATGTGGACTGATGTCGG 3').

Wads of cash held by rubber bands were produced.

The band that headlined this year's Glastonbury festival today released The Fall, an album that can be downloaded free and was largely produced using only an iPad.

A dendrogram was produced by using Dice coefficients and unweighted pair-group method using geometric averages (UPGMA), with 0.5% optimization and 1.25% band position tolerance [ 13].

The wavelength of the stimulation was produced by using a 475 nm narrow band interference filter (Oriel Corp., Stratford, CT).

The greatest number of bands (10) was produced by primer 329, while the A5 primer produced only one band.

If only a band of the smaller, deletion-bearing mtDNA was produced, that PCR product was purified using magnetic beads before sequencing.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: