Your English writing platform
Discover LudwigExact(1)
The detailed RSVP-TE state recovery generally follows RSVP-TE GR with minor modifications that can be performed in the background in parallel with normal RSVP-TE operations for connection setup and removal.
Similar(59)
Other factors that may influence the drug-specific rates include calendar year of drug start in parallel with the increasing background UK population rate of TB (12.3 to 14.7 events/100 000 person-years from 2001 to 200520) and increasing awareness of, and changing UK guidelines for, TB screening.
Under optimized conditions (see material and methods) we observed strong signal with the double-DIG-labeled miR-21 probe in parallel with little or no background stain, and no signal with the double-DIG-labeled scrambled probe (Fig. 1a, c).
Background intensity values, measured in wild-type worms treated in parallel with auxin, were subtracted from each measurement.
Students with some circuits background can take the course ELEN E1201in their first semester in parallel with the follow-on course ELEN E3201.Some have found this option workable.
Truncation was made by PCR either in parallel with mutation or separately on mutated background for constructs generated by Quickchange mutagenesis (Primer for truncation: 5'CGCTCTAGACTCGAGCTAAGACAGGCTTGAGTGGGACTTGGC3').
To determine the background from phosphate contaminations and unspecific phosphatase activities, the reactions were run in parallel with WT protein extracts.
Thus, its prevalence rises in parallel with the worldwide metabolic diseases epidemic, frequently developing on the background of obesity [ 3].
To rule out the possibility that the lifespan change may result from potential variation in genetic background among fly cohorts, lifespan assay for control flies with and without the Atg1Δ3D allele was also performed in parallel with Aβ1 42 flies.
Running tasks in parallel with 4 processors.
It could happen in parallel with a sugary drinks tax.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com