Protein-coding sequences were cloned into a pcDNA3 expression vector backbone, which was modified to contain either Renilla luciferase fragment 1 (Rluc8.1, amino acids 1 110) or Renilla luciferase fragment 2 (Rluc8.2 amino acids 111 312), each followed by a 2×(GGGS) linker, upstream of a Gateway cloning cassette allowing insertion of the gene of interest.
The retroviral backbone pMSCV-puro (Clontech) was modified to replace the puromycin selection gene with eGFP, to create pMSCV-IRES-eGFP, which served as the control vector.
In the present study, we utilized a TGF-β1-binding aptamer (IDT Technologies, San Diego, CA) having a loop structure with amino functionality at the 5′ and thiol functionality at the 3′ end.The backbone of single-stranded DNA aptamers was modified to have phosphorothioates (represented by "∗" in the aptamer sequence) on 5′ of both A and C.
For the BMI-1 knock down experiments, the pCLS lentiviral backbone was modified as follows: First, the rtTA IRES Puro expression cassette was amplified from pTRIPZ (Open Biosystems, Huntsville, AL) using the following primers: 5' TCACTCGGCGCGCCGCCACCATGTCTAGGCTGGACAA 3' and 5' TTTACTTGTACATCAGGCACCGGGCTTGCGG 3'.
The vector backbone was modified by insertion of the pgk/EM7 Neo/KanR-positive selection cassette pCEI1 [ 25] into the sacBII gene by bacterial homologous recombination in Escherichia coli SW102 [ 26].
The IgG1 backbone was modified so that the resulting plasmid p41D3 contains a C-terminal heavy chain multiple cloning site, allowing removal of the antibody's heavy chain stop codon and insertion of protein encoding sequences.
In the present study, an engineered template, in which the peptide backbone was modified by a heterocyclic reverse turn mimetic at the Trp residue, was synthesized using solid phase peptide synthesis and characterized by a β-galactosidase cAMP based reporter gene assay.
In addition to the backbone of Minos, MiMIC is modified to carry a gene trap cassette flanked by two inverted ΦC31 attP sites.
