Sentence examples for avoid any repeats from inspiring English sources

Despite the strangeness of the scene at Comerica Park and the lengths the Tigers have taken to avoid any repeats of 2006, Leyland was in high spirits.

The state insists new monitoring equipment and extra training for the executioners will avoid any repeat tragedy.

The two parties are keen to avoid any repeat of 1987, when they were also in a coalition and failed to tackle an earlier Irish economic crisis.

The Department for Transport is working with the airport authorities to try to put in place acceptable standards of security to avoid any repeat.

A first draft of the declaration, drawn up by France and Germany, called for the European Council -- the body in which leaders from the European Union meet -- to become a form of "economic government" for the bloc, and for much tighter controls on member states to avoid any repeat of the Greek crisis.

But Jimmy Adams (25 not out) saw them home to avoid any repeat of the drama at Taunton last Wednesday, when Somerset crumbled to 77 all out as their game against Lancashire ended in a tie.

"We will be holding a full investigation into the incident with Network Rail as part of our follow-up to help avoid any repeat of this problem and the widespread disruption caused".

Soon after the alleged theft, Williamson said the organization established a set of practices for handling mail and finances to avoid any repeat incidents in the future.

Probes were designed from within the 12 kb repeat units using PCR primers from conserved regions, which amplified a 2 kb fragment (Gor1AL- TGGATGATCTGTGCCAGGTA and Gor1AR- AAGGAGAAGTCCCACCCAGT) and a 1.6 kb fragment (Gor1BL- GGGTAGAGGAGGGTGAAAGG and Gor1BR- TTGGAACCATGCGAGTGATA, which were designed in "unique" sequence and avoided any Repeat Masked sequences.

The purpose of this design is to avoid any potentially repeated concept names.

Perhaps, but it's definitely in Mr. Altuzarra's interest to avoid any confusion, or repeated coincidences.