avoid any mismatch

USAGE SUMMARY

The phrase "avoid any mismatch" is correct and usable in written English.
You can use it when discussing the need to prevent discrepancies or inconsistencies in various contexts, such as data entry, project management, or communication. Example: "To ensure a smooth workflow, we must avoid any mismatch between the project requirements and the deliverables."

✓ Grammatically correct

Science

News & Media

Wiki

Human-verified examples from authoritative sources

Exact Expressions

1 human-written examples

Before installing your new camshaft, make sure to check the part numbers of the camshaft and valve gear components against the manual, to avoid any mismatch of equipment due to a shipping error or a mistake at the shop.

WikiHow

Human-verified similar examples from authoritative sources

Similar Expressions

59 human-written examples

To avoid any matrix mismatch, the final DMSO concentration was adjusted to 0.1% (volume) in all samples and running buffer.

Analytical Chemistry

Based on these observations, the ideal vascular graft should resist the physiological arterial pressure and should avoid any mechanical mismatch.

BioMed Research International

A weather index insurance contract needs to account for such changes to avoid any biases and mismatches in payout calculations relative to the loss incurred at local level.

Agricultural and Food Economics

Online determination of the TEs and line parameters ensures avoiding any possible mismatch with the actual parameters due to system loading and other environmental conditions.

Electric Power Systems Research

On Monday, Gilles Simon took to the court at the Australian Open after a marathon in the previous round and could not muster the energy, the precision or the belief to avoid a mismatch in his fourth-round encounter with Andy Murray.

The New York Times - Sports

To avoid a mismatch caused by an additional A base at the 3' end produced by Taq polymerase, all the overlapping primers start after a T base.

Plosone

A 6347 bp fragment including the entire Fas2 gene was cloned by PCR with the use of primer pair: Fas2ReF: CGGGGTACCTTCTTTGGAATCTAGTGTCGTGT; Fas2ReR CCGCTCGAG TGACTCTCACAGCTTGTTTTGTC. Since this is a long PCR product, the long expand Taq polymerase Kit (Roche) was used to avoid a mismatch.

Plosone

Health professionals should avoid a mismatch between the parent's expectations and needs and their own assumptions.

BMC Pediatrics

In the case of a generator change, one has to know the type of connector in order to avoid a mismatch between the lead and the generator.

Europace

To avoid a mismatch between identified barriers and interventions, the target users of the guidelines should be actively involved in selecting the interventions that will overcome the barriers they encounter in practice.

BMC Medical Education

Expert writing Tips

Best practice

When using "avoid any mismatch", consider the potential consequences of a mismatch, and emphasize the importance of preventive measures.

Common error

Avoid using "avoid any mismatch" as a generic filler phrase. Ensure it is relevant to the specific situation and that a potential mismatch is a genuine concern, not just a hypothetical possibility.

Linguistic Context

The phrase "avoid any mismatch" functions as a purpose connector, indicating the reason or objective behind an action. It is used to highlight the importance of preventing discrepancies or inconsistencies in a given situation. Ludwig confirms the correct and usable nature of this expression.

Expression frequency: Uncommon

Frequent in

Science

68%

News & Media

14%

Wiki

5%

Less common in

Formal & Business

5%

Encyclopedias

0%

Social Media

0%

Ludwig's WRAP-UP

The phrase "avoid any mismatch" serves as a purpose connector, underlining the necessity of preventing inconsistencies across various contexts. Ludwig confirms that the expression is both grammatically sound and practical for use. While applicable in diverse scenarios, it is especially prevalent in scientific and technical fields where precision is key. When using the phrase, it's crucial to clearly define what constitutes a "mismatch" within your specific context to ensure clarity. Alternatives include phrases like "prevent any discrepancy" and "avoid inconsistencies".

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

prevent any discrepancy

Replaces "mismatch" with "discrepancy", focusing on preventing differences.

avoid inconsistencies

Simplifies the phrase, directly addressing the avoidance of inconsistencies.

ensure alignment

Shifts the focus to ensuring things are aligned rather than avoiding mismatch.

prevent any conflict

Focuses on preventing conflict or clashes between different elements.

eliminate discrepancies

Highlights the act of removing existing discrepancies rather than preventing them.

forestall any incompatibility

Uses more formal language, emphasizing the prevention of things not working together.

preclude any variance

Emphasizes the act of preventing deviation or variation.

avoid any divergence

Focuses on preventing things from moving apart or becoming different.

guarantee consistency

Shifts the focus to ensuring a consistent outcome, indirectly addressing the avoidance of mismatch.

obviate any incongruity

Uses more formal and less common language to convey the prevention of something being out of place.

FAQs

How can I use "avoid any mismatch" in a sentence?

You can use "avoid any mismatch" when you want to express the need to prevent inconsistencies or discrepancies. For example: "To ensure a smooth workflow, we must "avoid any mismatch" between the project requirements and the deliverables."

What are some alternatives to "avoid any mismatch"?

You can use alternatives like "prevent any discrepancy", "avoid inconsistencies", or "ensure alignment" depending on the context.

Is it better to say "avoid any mismatch" or "prevent any mismatch"?

"Avoid" and "prevent" are often interchangeable. "Prevent any mismatch" might sound slightly more proactive, but the choice depends on the specific context and desired emphasis. Both are grammatically correct.

What does "avoid any mismatch" mean in the context of data entry?

In data entry, "avoid any mismatch" means to ensure that the data entered is accurate and consistent with the source documents or systems. This prevents errors and ensures data integrity.