Sentence examples for available for use when required from inspiring English sources

Exact(3)

Availability is the probability that a system is available for use when required.

Presence of use fees implied that health workers had resources available for use when required, as opposed to the public resources that have stringent guidelines for spending and accountability attached to them.

To ensure that GSCs are available for use when required, the cells were periodically cryopreserved and resuscitated during long-term culture and tested for their capacity to form new nonadherent tumor spheres upon retrieval.

Similar(57)

It could be left largely unimplemented, but always available as a tool to use when required.

Use when required.

Assistance will be available from school staff when required.

A credit card is available for use immediately and requires no paperwork, unlike other financing options.

Health workers also have influence on whether drugs and other supplies are available when required: they can conceal available stocks, and can use initiative to replace drugs that are out of stock at the time, for example.

The regulator must develop a consistent methodology for inspectors to follow that will ensure clinical experts are available when required.

Power from these resources may not be available when required.

Primer sequences are available when required, GAPDH-1 (GCCCAATACGACCAAATCTAA) and GAPDH-2 (ATTGTTGCCATCAATGACCC) are the primers from two HindIII restriction fragments of the GAPDH gene used for correcting different template amount.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: