Sentence examples for at the forward end from inspiring English sources

Additionally, some ornithischians have a projection at the forward end of the pubis.

One tube is open at the forward end; the opening is referred to as the dynamic-pressure orifice.

The most significant impacts are related to the geometric differences in Orion Crew Exploration Vehicle at the forward end of the stack.

At the forward end of the body is a preoral lobe, behind this is a collar, and last comes a trunk.

In saurischian dinosaurs, this bone points toward the front of the animal, and flares into a keel at the forward end.

A ship will vibrate due to the pounding effect at the forward end and also due to wave frequency acting at the same frequency as that of the hull.

Three- and four-cylinder engines have only one turbocharger, mounted at the forward or aft end, while two or three chargers have been fitted to seven-, eight-, and nine-cylinder engines.

Three- and four-cylinder engines have only one turbocharger, mounted at the forward or aft end, while two or three chargers were fitted to seven-, eight- and nine-cylinder engines.

Directed movement is most efficient if sensory organs are located at the head or forward-moving end of the animal.

BamHI/EcoRI sites and XhoI sites were introduced at the end of forward and reverse primers respectively (restriction enzyme sites are underlined): SERA3/for (5′-GT GGATCCATGGCACGTCTCTCATCAAT-3′) and SERA3/rev (5′-GT CTCGAGATGTGGTGAAAATTGAACTCTGAA-3′); SERA1/for (5′-GTGT GAATTCTTAGATGCAGCCGACACAAGAATTCTTAGATGCAGCCGACACAAG-3′CGAGTTATCCTTCTCCAGTTGGTTGATG-3′).

The PH-PKB-mCherry sequence was amplified by PCR using primers to incorporate Xba1 and Sma1 sites at the 5' and 3' ends (forward: 5'-AAAATCTAGAATGAACGACGTAGCCATTGTGAA; reverse 5'-TGAATTCCCGGGTTACTTGTAGAGCTCGTCCATGC).