Sentence examples for at housekeeping from inspiring English sources

One day when she is 6, while playing at housekeeping under a red-currant bush, Eva is visited by a woman and a girl.

Although he agreed that the pigsty was, like the horse's stall, far from fragrant, he was able to recognize the pigs' attempt at housekeeping.

One tip: "Be mindful that people can feel embarrassed about their failures at housekeeping," said Gretchen Kubacky, a psychologist based in Los Angeles.

TFIID dependence on Bdf1 for promoter recruitment is common at housekeeping genes that generally have TATA-less promoters.

Adept at housekeeping tasks, including but not limited to laundry, making beds, dusting, organizing mail, and running errands.

ChIP revealed similar chromatin states at the promoters with the palindromic motif and at housekeeping gene promoters.

MLST defines the ST239 clonal group based on sequences at seven housekeeping loci, whereas SAS uses sequences at seven loci that encode putative or proven surface proteins.

This was achieved by conducting a no-RT endpoint PCR reaction targeted at the housekeeping BvEF1a gene, using primers: L1: GATTCCCACCAAGCCTATGG and R1: GATGACACCAACAGCGACAG, optimised at 150 nM and 60°C.

"At worst, housekeeping committees may provide legal cover for corruption or engender the appearance of corruption".

"Today, in addition to the investigation into the Legislature, the Moreland Commission has moved to look across the board at all housekeeping accounts," they said.

There are occasions when one country's attempts at good housekeeping make it harder for other countries to be domestic goddesses themselves.