Sentence examples for at each terminus from inspiring English sources

There are no buffet cars, and train staff are expected to clean up the carriages at each terminus.

Turntables were placed at each terminus.

To enrich for targeting SLiMs, we restricted analysis to the 20 amino acids at each terminus.

For effective annealing, one more nucleotide was added at each 5' terminus [10].

DsbD is a three-domain protein comprising a transmembrane region with a soluble periplasmic domain at each terminus [10].

The resulting fragments contain either the 3' or 5' terminal sequence of IS 6110, the flanking genomic sequence, and two different barcodes at each terminus.

In order to incorporate restriction site sequences at each termini of the 601 sequence, plasmid DNA was used as a PCR template using the following primers: forward 5′ – CTCGGAATTCTATCCGACTGGCACCGGCAAG – 3′ (EcoRI) and reverse 5′ – GCATGATTCTTAAGACCGAGTTCATCCCTTATGTG – 3′ (Bst98I).

The stem-loop structured oligodeoxyribonucleotide (ODN) having a molecular beacon sequence for point mutated K-ras mRNA was doubly labeled with bis trifluoromethyl benzene moiety and Gd-1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid chelate moiety at the each termini of the ODN probe, respectively.

Here, to overcome these limitations, we designed and constructed the novel type of hybrid mussel bioadhesive fp-151, a fusion protein comprising six fp-1 decapeptide repeats at each fp-5 terminus.

Since the cDNA-AFLP procedure uses a two selective nucleotide extension at the 3' terminus of each primer (See methods), there are 256 available primer combinations.

This junction consisted of the original T-shaped junction, but at the terminus of each horizontal junction there was a replicate T-shaped junction (see Figure 3 ).