Sentence examples for at each termini from inspiring English sources

In order to incorporate restriction site sequences at each termini of the 601 sequence, plasmid DNA was used as a PCR template using the following primers: forward 5′ – CTCGGAATTCTATCCGACTGGCACCGGCAAG – 3′ (EcoRI) and reverse 5′ – GCATGATTCTTAAGACCGAGTTCATCCCTTATGTG – 3′ (Bst98I).

There are no buffet cars, and train staff are expected to clean up the carriages at each terminus.

Turntables were placed at each terminus.

For effective annealing, one more nucleotide was added at each 5' terminus [10].

To enrich for targeting SLiMs, we restricted analysis to the 20 amino acids at each terminus.

DsbD is a three-domain protein comprising a transmembrane region with a soluble periplasmic domain at each terminus [10].

In this study, we determine the NMR structure of an Aβ17 34 peptide solubilized by the addition of two glutamic acids at each terminus.

The resulting fragments contain either the 3' or 5' terminal sequence of IS 6110, the flanking genomic sequence, and two different barcodes at each terminus.

The utilized probes have been termed PRI-lock probes and they consist of two target complementary regions, one at each terminus of the probe.

Run buffer conductivity in the fsPAG structures was estimated to be similar to that of PAG in glass microfluidic chips, as described by Duncombe et al. The mobility and diffusivity of the model protein, TI, was estimated as per Herr and Singh and Hughes et al. The voltage boundary conditions were set at each terminus of the fsPAG structure.

To determine the coupling efficiency 5 μl of particle suspension were mixed with 50 200 ng of a 2,000 bp PCR-amplified DNA fragment, carrying a digoxygenine and a biotine modification at each terminus, respectively, in a total volume of 10 μl PBS.