The phrase "at each extremity" is correct and usable in written English.
It can be used to describe something located at both ends or limits of an object or area.
Example: "The fence was painted a bright red color at each extremity to make it more visible."
Alternatives: "at both ends" or "at either end".
At each extremity there is a great bend in the system's alignment, from which a number of lower mountain ranges and hills spread out.
In addition to the usual direct repeats (DR) at each extremity of SCCmec, M1 had two new DR between the orfX gene and the J3 region of the SCCmec.
In addition to the usual direct repeats (DR) at each extremity of SCCmec (DR1 and DR4 in Table S1 and Figure 1), two DR were identified in M1 (DR2 and DR3 in Table S1 and Figure 1).
– Known from Isle of Skye (unknown depth) and Shetland Islands (132.2 m depth), Scotland, U.K. The supplementary description herein agrees with the size and shape of the holotype, and with Baird's description [7], which states "carapace valves elongate, oval, of exactly the same size at each extremity; extremities rounded.
For cyclic peptides, cysteine residues were added at each extremity to create a disulfide bridge.
Four flanking genes at each extremity were mapped in most instances.
The 35 oligonucleotide probes included the specific sequences (X 31 targeting cDNAs encoding GH11 and adaptor sequences at each extremities for PCR amplification: ATCGCACCAGCGTGT- X 31-CACTGCGGCTCCTCA (SupplementATCGCACCAGCGTGT- X 31-CACTGCGGCTCCTCA
A first hybridization was performed at 42°C for 48 h using a P-labelled oligonucleotide (TAATACGACTCACTATAGGG, sequence which is present at the extremity of each PCR product) to monitor the amount of cDNA in each spot.
A first hybridization was performed using a 33P-labelled oligonucleotide (TAATACGACTCACTATAGGG which is present at the extremity of each PCR product) to monitor the amount of cDNA in each spot.
The cat was a large rope of many strands — the strands unraveled, and a knot tied at the extremity of each.
Flexible connections between cars give passengers access to any car of a moving train, except when the coupling together of self-powered, reversible train-sets for multiple-unit operation makes passenger communication between one train-set and another impossible, because there is a driving cab at the extremity of each unit.
