Sentence examples for assessed using primers from inspiring English sources

ISSR diversity was assessed using primers described by Poulin et al. [12].

Crenarcheal communities were assessed using primers targeting the 16S rRNA gene; 133FN6F-NED labelled and 248R5P [53].

Proper incorporation of the hph cassette at the BAR1 locus was assessed using primers P1 P6 and Taq polymerase (Invitrogen) according to the manufacturer's instructions (Fig. 1).

DNA quality was assessed using primers for the porcine prolactin receptor gene [ 27].

Mitochondrial DNA was assessed using primers, 5'-CTCTTAT CCACGC TTCCGTTand-3' and 5'-GATGGTGGTACTCCCGCT GTA-3' for the mitochondrial-encoded ND1 gene.

Expression of MAP2K4 was assessed using primers listed in Additional file 2, Table S2 on the LightCycler® 480 (Roche Diagnostics, Mannheim, Germany).

Tri5 transcription was assessed using the primers Tri5_864F and Tri5_1070_R, Tri6 with primers Tri6_253_F and Tri6_ORF_R, Aur1 with Aur1_1043F and Aur1_stop_R, Pks12 with Pks12_1100F and Pks12_R.

Total RNA in the samples was assessed using rp49 primers 5'agtatctgatgcccaacatcg3' and 5' ttccgaccaggttacaagaac3'. High fidelity pfu turbo enzyme (Stratagene) was used for all PCR reactions.

MTSS1 mRNA levels were assessed using MTSS1 primers: (sense: TGG GTCCACTGAGCCCCACACATTGTTG and antisense: GGTGGCCATTGTGGG GTGGAATG -AA).

Psoriasin mRNA levels were assessed using Psoriasin primers as follow: F: 5-GGGCACAAATTACCTCGCGA, R: 5-CACTGGCTGCCCCCGGAAC.

Cat, chloramphenicol acetyltransferase gene, was assessed using the primers and PCR conditions described by Hummel et al. [ 33].