Your English writing platform
Discover LudwigThe phrase "assess standard deviation" is correct and usable in written English.
You can use it in contexts related to statistics or data analysis when evaluating the variability or dispersion of a dataset.
Example: "To understand the spread of the data points, we need to assess standard deviation."
Alternatives: "evaluate standard deviation" or "analyze standard deviation."
Exact(2)
A standardized on-the-road driving test was used to assess standard deviation of lateral position (SDLP), a measure of weaving.
The reactions were performed in an ABI Prism 7700 machine with real-time SYBR Green I detection using default parameters and the primers 5'andGAGCAGGATGTGAAATG3' and 5'AACGAGCAGGATGTGAAATCG3'. Reactions were performed in quadruplicate for each template to assess standard deviation of threshold cycle (Ct) measurements of the amount of CrChlI transcripts in the green and colorless samples.
Similar(58)
Indeed, in the human genome [ 9], isochores were taken to be at least 200 kb in size, a condition linked to the need of assessing standard deviations of the 100 Kb segments used in the analysis.
NMAE represents how close are the forecast results to the final outcomes and the NRMSE assesses the standard deviation between the forecast value and actual value, which reflects the stability of the forecast model.
Inter-subject variability was assessed as standard deviation (SD) of the distribution of the respective SUV.
Daily glycemic variability was assessed using standard deviation (SD) [ 29, 35- 37].
Independent 100 tracks of total 30 repeats were used for assessing the standard deviation.
A 25% burn-in was chosen and convergence was assessed by standard deviation of split frequencies falling below 0.005.
TF target search simulation experiments were performed independently 100 times of total 10 repeats for assessing the standard deviation.
TF target search simulation experiments were performed independent 100 times of total 10 repeats for assessing the standard deviation.
The first study by Jossinet investigates the variability of the impedance data within each group by assessing the standard deviation and the reduced standard error [ 8].
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com