Sentence examples for assayed through the from inspiring English sources

NuDNA was assayed through the amplification of a fragment of 28s ribosomal DNA (250 345 bp depending on species).

The effect of DIM on the invasive potential of BCPAP, 8505C, CGTHW-1 and ML-1 was assayed through the use of a transwell invasion chamber coated with a biological matrix in vitro (matrigel).

Forty-seven percent (50/109) of these women had their 25OHD levels additionally assayed through the use of whole blood and 19% (20/109) had levels assayed using an available serum sample.

MtDNA was assayed through the amplification of a short (220 bp) fragment of the cytochrome c oxidase I (CO1) gene using primers ShortF (5' CAATTTCCAAATCCNCCAAT) and ShortR (5' GGTCAACAAATCATAAAGATATTGGAA, annealing temperature 50°C).

Enzyme reaction mixtures were then assayed through the use of the Pierce ® Quantitative Peroxide AssayKit.

Caspase-3 activity assayed through the use of the Caspase-3/CPP32 Fluorometric Assay Kit (BioVision, Mountain View, CO, USA).

The cytotoxicity of the anti-malarial drugs was evaluated on M. fascicularis hepatocytes treated as for the drug activity assays, through the colorimetric methylthiazolyldiphenyl-tetrazolium bromide test (MTT) [27].

Compound 159, the N-hydroxy analogue of 158, displayed 3 times increase in blood-brain barrier permeability compared to lucifer yellow as determined by in vitro transport assays through the hCMEC/D3 human brain endothelial cell line.

In contrast, several thousand SNPs can be simultaneously assayed through automation, reducing both the size of the confidence intervals around parameter estimates and cost.

Gene expression was assayed by Real Time PCR. Cell invasiveness was assayed through a Matrigel invasion assay; cell proliferation was determined through the soft agar assay, MTT, and [H] thymidine incorporation.

Folding of CFTR and NBD1 was assayed through protease susceptibility.