The hexaploid cultivars 'Baldus' (CGN19285) and 'Lavett' (CGN23549) and the tetraploid (AABB) cultivar 'Probstdorfer Pandur' (CGN08262) were assayed for the frequency of the Gli-A2 sequences in the α-gliadin transcriptome at three developmental stages; 7 days post anthesis (DPA), 14 DPA and 21 DPA.
Those listed in Table 1 were assayed for Gli-A2 frequency in cDNA of developing wheat grains by pyrosequencing.
Twenty-four hours later, the selection was removed, and surviving cells (GC16A) were assayed for gene-editing frequency by sequencing the CYBB locus using PCR primers gp91forward1 (GGTATACTGGCCAAATCATA) and gp91reverse4 (AATTGTTGGAGTGAGAGTCAA).
This method is particularly suitable for genotyping or resequencing studies in which TEs identified in a well-assembled genome are subsequently assayed for their allele frequency in populations (Blumenstiel et al. 2002; Petrov et al. 2003, 2011; Franchini et al. 2004; Neafsey et al. 2004; Lipatov et al. 2005; Gonzalez et al. 2008).
We induced clones in paired control and experimental groups, and assayed for FSC clone frequencies at 7, 14, and 21 dpci.
We generated either wildtype (control group) or Egfr f24 (experimental group) GFP clones under identical conditions (See 'Materials and methods') and assayed for FSC clone frequencies at 4, 7, and 11 days post clone induction (dpci).
In three additional colonies assayed for mite biting behavior, the average frequency of grooming (anova: F = 0.7956, P = 0.4645) and the average biting events (anova: F = 0.7033, P = 0.5049) did not differ among nurses, guards, and foragers.
We tested this conclusion by growing 1.65 × 10 Fhit-deficient and UVC-surviving Fhit-deficient cells in 6-thioguanine and counting surviving colonies, as an assay for frequency of HPRT mutations.
The recovered pathogen populations were assayed for their molecular markers so that frequencies of the inoculated isolates could be compared across hosts and sampling times (see Figure 1).
Peripheral blood mononuclear cells, platelets and neutrophils were removed from freshly drawn whole blood and pRBCs matured in culture for 24 h before being assayed for rosette and 4-HNE conjugate frequencies as described above.
