Sentence examples for assay site from inspiring English sources

Also, in a DNase footprint assay, site −96 was located between two regions protected by UBF, and showed enhanced DNA cleavage [41].

The AMPLICOR assay (site 5) failed to detect 11/15 replicates (73%), whereas the Affigene CMV trender test (site 3) was able to quantify 15/15 replicates.

However, in nine cases the HSPs showed one or more additional sequence polymorphisms close to the assay site so that this particular assay would not have been selected based on the HSP sequences.

Primers were used as following: for p53 binding site assay: Site 1: FMA53-1, gatagacctggggaccttgc, RMA53-1, athetcgctgcamplifiedthe amplifragmentgment was 113 bp; Site 2: FMA53-2, ctcacctgcagcgaccat, RMA53-2: ctctcggggccandthec, amplifiedmplifragmentgment was 112 bp.

The assays were developed such that the gene(s) and or homoeologs to be tested showed several mismatches and/or indels as close to the assay site as possible when compared to other homologs present in the Brassica napus genome.

In case other homologous sequences had been identified in the progenitor genomes it was taken care that they were differentiated from the assay sequences by mismatches and/or indels as close to the assay site as possible.

Using our semi-quantitative cell-surface binding assay, site-directed mutational analysis, and genetic engineering we defined short distal regions of the displayed polypeptides necessary and sufficient for CdS binding.

In the previous assay, site-specific labeling at cysteine residues was used to create the LRET pair.

In order to verify the putative target genes of miR-17 and miR-92 families by the dual-luciferase reporter assay, site-directed mutagenesis (MUT) were performed in the 3′-UTR of CDKN1A and RAD21 (Fig.  2a).

Express across all assay sites.

At 39 SNP assay sites Brassica napus var.