Sentence examples for assay population from inspiring English sources

We minimized this variability in the assay population by using the COPAS™ BIOSORT to collect a precise number of animals using a tightly-gated size and fluorescence intensity window.

In every single assay population, the mutant (Hsp83 P) allele frequency decreased over the course of the experiment.

To assay population levels of diversity, PCR primers (LehoIIBUpper: 5΄− GCGAAGTCTCAGTGTT −3΄ and LehoIIBLower: 5΄− CTTGTCTACAGTGTAAGGTT −3΄) were designed using Oligo6 (Molecular Biology Insights, Inc), targeting a 249 252 bp fragment within exon 2 of the MHC DAB gene (full length of exon 2 predicted to be 282 bp).

This single base extension (SBE) based microarray platform was designed and optimized using poliovirus as the target genotype, but can be easily adapted to assay populations derived from any organism.

Like in the assay populations, densities were higher in uninfected than infected lines.

In an additional experiment, we measured clonal growth and survival of infected individuals isolated from the assay populations.

Such separation is necessary in order to accurately assay populations of putative mammary stem cells by cleared fat pad transplantation.

Urbanelli and others 17 used DV/D ratios and a panel of six allozymes that included several new loci to assay populations in California.

To follow the subsequent development of infection, we sampled infected assay populations at different time points over the course of two weeks.

As the choice to retain the oldest 2% of surviving females was based on human population data, and not informed by Drosophila biology, a cursory analysis of aging trajectories in the assay populations is merited.

More work though needs to be done on pesticides assaying population differences in general and specifically across historic pesticide use gradients.