The phrase "assay code" is correct and usable in written English.
It can be used in contexts related to scientific testing, particularly in chemistry or biology, where it refers to a specific code or identifier for an assay.
Example: "Please refer to the assay code provided in the documentation to ensure accurate results."
Alternatives: "test code" or "analysis code".
Primers specific for EP2 (Qiagen Quantitect Primer Assay, code: Hs_PTGER2_1_SG; Qiagen) or EP4 receptors (Hs_PTGER4_2_SG) or, for calibration, primers for GAPDH (forward, ACCACAGTCCATGCCATCAC; reverse, TCCACCACCCTGTTGCTGTA) were used.
Human plasma concentrations of total GLP-1, GIP, insulin (INS), glucagon (GCG), and intact neutrotensin1 13 (NTS1–13) were determined using in-house radioimmunoassays (assay code: GLP-1total, 89390; GIPtotal, 80867-5; INS, 2004-3; GCG, 4305-8; NTS1–13, 3844-5) with I-labeled tracers and hormone-specific antiserum, recognizing COOH-terminal epitopes, as described previously (11, 16, 12a, 12b).
We determined the plasma CRP levels in fresh plasma samples by using a high-sensitivity nephelometry assay (CardioPhase hsCRP, code OQIY21, Dade Behring, Deerfield, IL, USA) performed on a Behring Nephelometer or a high-sensitivity turbidimetry assay (Code LX001, Dako, Glostrup, Denmark) performed on a Konelab 60 analyzer.
The assay codes can be found in Table 1.
Primers for crystallin α A (Cryaa) and crystallin γ f (Crygf) were purchased from Qiagen (Quantitect primer assay, codes 12954 and 12969 respectively).
The assay codes of the primers are shown in Table 1.
In summary, we have successfully generated hybrid split tracr molecules, with the most efficient hybrid split tracrXNA molecules in biochemical assays coded by 50 70% DNA.
Manually designed assays coding for short, medium-size and long amplicons of the insulin growth factor-binding protein 5 (IGBP5) were selected with Primer Express (Version 3, Applied Biosystems).
Development of the definition included examination of a number of ICD-9 codes for Alzheimer's disease, number of codes plus an "event" (neuroimaging, B12, TSH assays), codes by specialty providers vs. generalists, and fills for dementia drugs.
Under this model, the most cost-effective strategy for fine mapping would focus on assaying coding variation, which can most comprehensively be achieved through whole-exome re-sequencing of cases and controls, and will provide a complete catalogue of protein altering variants across the genome.
6-Sulfatoxymelatonin was assayed using the Bühlmann enzyme-linked immunosorbent assay (product code EK-M6S; Bühlmann Laboratories AG, Schönenbuch, Switzerland).
