Sentence examples for ascertain the continuity from inspiring English sources

The phrase "ascertain the continuity" is correct and usable in written English.
It can be used in contexts where you need to determine or verify the ongoing nature or consistency of something, such as a process or a relationship.
Example: "The team was tasked to ascertain the continuity of the project's funding to ensure its success."
Alternatives: "determine the continuity" or "verify the continuity".

Exact(1)

To ascertain the continuity of the LfHha locus, partial exon1-exon2-partial exon3 was amplified from Lampetra cDNA obtained previously [23] with primers His_hha_for3 (GTCGCTACGAGGGGAAGAT) and His_hha_rev2 (TTCACGCACGAACACAAAGT), followed by cloning into pGEM®-T Vector and sequencing.

Similar(59)

Occasionally, Emil made phone calls to ascertain the progress.

They do not get the facts; they "ascertain the data".

Swedroe again used Morningstar data to ascertain the correct benchmark.

He used a device to ascertain the truth".

In stage III, we used this measure in a cohort of patients with cancer to ascertain whether continuity of care was associated with their health needs, psychological status, quality of life, and satisfaction with care.

'The exercise of ascertaining the facts was a serious one".

Thus it ascertains the two".

They checked, corrected, ascertained and re-ascertained the data.

Again, the 'standard' interpretations were originally united in perceiving a clear break between the two distinct stages of Wittgenstein's thought, even when ascertaining some developmental continuity between them.

The aim of this study was to ascertain: how personal, longitudinal continuity of care is related to certain patient characteristics; and what were patients' experiences of consultations with doctors working in Finnish primary care centres.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: