Sentence examples for as underlined previously from inspiring English sources

58, 59 As underlined previously, IPC was first identified in the heart and successively in the brain.

The restriction enzyme names are within parentheses, and their sequence in the primers indicated as underlined.

The gene was amplified by PCR method using the following two primers with NheI and HindIII restriction sites: TATATAGCTAGCATGTCCACGACGG (upper primer, NheI cutting site as underlined); CGTCGCAAGCTTGAGCTACTTAAC (lower primer, HindIII cutting site as underlined).

In each column, the best results are shown as underlined.

Failed tests with item convergent validity are shown as underlined.

Nucleotide differences in reference and query sequences are indicated as underlined and uppercased alphabets, respectively.

The added results are presented as underlined parameters in table 9.

Look around your community, as said previously.

Rinse and dry as previously explained.

Underlined genes were previously described as SigH-dependent [ 14, 16].

In each region, a reference node is considered and shown as an underlined alphabet, as shown in Fig. 8.