Sentence examples similar to as underlined for from inspiring English sources

Thirteen out of 18 populations had data available for both per gene and CHCs and were used for phylogenetic reconstruction (shown as underlined).

The restriction enzyme names are within parentheses, and their sequence in the primers indicated as underlined.

The gene was amplified by PCR method using the following two primers with NheI and HindIII restriction sites: TATATAGCTAGCATGTCCACGACGG (upper primer, NheI cutting site as underlined); CGTCGCAAGCTTGAGCTACTTAAC (lower primer, HindIII cutting site as underlined).

In each column, the best results are shown as underlined.

Failed tests with item convergent validity are shown as underlined.

Nucleotide differences in reference and query sequences are indicated as underlined and uppercased alphabets, respectively.

The added results are presented as underlined parameters in table 9.

But the iPhone saga and the raid have underlined for Denton the contrast between what he describes as the mischievousness of Gawker and Apple's control-freakery.

The combination of pepper spray, Swat teams and judicial torture – for that is what it was – underlined for me a strain of American life that is forever present but rarely makes itself so boldly visible as it has this week.

The primers contained restrictions sites NdeI and XhoI (underlined) for forward and reverse primers, respectively.

As above underlined, in the proposed study, it is possible to refer to single pile impedances, without accounting for the group effects.