Sentence examples for as single strand from inspiring English sources

Suggestions(1)

The phrase "as single strand" is not correct in standard written English.
It may be intended to describe something that is in a single strand form, but it lacks clarity and grammatical structure.
Example: "The DNA was observed as a single strand during the experiment."
Alternatives: "in a single strand" or "as a solitary strand".

Exact(14)

The oligonucleotide and the RNA target both start out as single strand molecules, but when they bind they can form a double helix like DNA, Inoue explains.

If the speed of advancement in this area continues apace, even some of the more formidable challenges, such as single strand sequencing and the $1,000 genome, might be overcome not just in our lifetimes, but within the foreseeable future.

Second, mRNAs are much smaller than DNAs, and as single strand nucleic acids without any flanking plasmid sequences they can be introduced into cells with higher efficiency and much lower cytotoxicity.

We used the HMR silencing assay in the presence of camptothecin to determine whether the fun30 null allele has a direct effect on silencing or if the silencing phenotypes are caused indirectly by fun30 through constitutive activation of a pathway(s) normally induced by the presence of roadblocks such as single strand nicks with a covalent DNA-protein bond.

These studies used prescreening methods such as single strand conformation polymorphism (SSCP) before sequencing aberrant products or mutation-specific techniques.

The efficacy of the three agents to induce DNA damage, which was assessed as single strand break (SSB) formation, was evaluated.

Show more...

Similar(46)

Thus, being independent from primer libraries or PCR laboratory conditions, the probe sequences extracted by computer sequence data base search can also be synthesized as single stranded PNA-probes (Peptide Nucleic Acid probes).

As single stranded DNA molecules represent intermediates in the chimera formation during MDA, S1 nuclease treatment has been suggested and shown to reduce chimerism [18].

For example, within the broader categories such as single stranded, positive sense RNA viruses, we selected prominent pathogens such as measles virus, RSV, Mumps, rabies virus, Ebola virus and all influenza viruses as representative of the group.

Synthetic oligonucleotides encompassing the putative κB sites of the promoter region of the human COQ7 gene (κB1F- TAAAGCAGGAAATACCGTGCCT; κB1R- AGGCACGGTATTTCCTGCTTTA; κB2F-AGCTAGGGAATTTTCGCTTGA; κB2R- TCAAGCGAAAATTCCCTAGCTC) were purchased from MWG Biotech AG (Germany) as single stranded oligonucleotides.

The Willis lab demonstrated that the PTB1 binding site, a CCU repeat, can only internally initiate translation when present within a stem structure and not as single stranded RNA [31].

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: