SCEN and LEIF were both initially developed to provide independent and competent second physicians as consultants in euthanasia requests, as required by law (Table 2); these physicians are however also able to provide information and support concerning euthanasia outside the context of consultation.
Advise table hosts as required.
The T7 promoter sequence 5′GGATCCTAATACGACTCACTATAGGA3′ was added in front of the forward and reverse PCR primers as required for subsequent dsRNA synthesis (Table 1).
Furthermore, we plan to extend CrasyDSE by adding further approximation methods or new solving algorithms to the ones given in Table 4 as required by individual cases.
Sensitivity, specificity, predictive values and percentage correctly classified for POC and laboratory measurements ≥6.5%, 48 mmol/mol are listed in table 2. As required for diagnostic tests, POC HbA1c testing had a high specificity (98.2%; 95% CI 95.1%too 99.4%) for predicting diabetes.
Sensitivity, specificity, predictive values and percentage correctly classified for POC measurements ≥5.7%, 39 mmol/mol and laboratory measurements ≥6.0%, 42 mmol/mol are listed in table 2. As required for screening tests, POC HbA1c testing had a high sensitivity (91.0%) for detecting people with diabetes or a high risk of developing diabetes.
The complexity of PSO is expressed as the number of required flops in Table 1 where k is the number of iterations and n is the number of initial solutions or the swarm population.
(Those amounts are different from what appears in the proxy's main "summary compensation table," which, as required under the Securities and Exchange Commission's new rules, factors in expenses for stock grants in previous years).
As expected, more interventions including repeated LPI, cataract extraction and trabeculectomy were required in the PACG group (Table 5).
