as previously underlined

USAGE SUMMARY

The phrase "as previously underlined" is correct and usable in written English.
It can be used to refer back to something that has been emphasized or highlighted earlier in the text. Example: "The key points of the argument, as previously underlined, are crucial for understanding the overall thesis."

✓ Grammatically correct

Science

News & Media

Wiki

Human-verified examples from authoritative sources

Exact Expressions

10 human-written examples

As previously underlined, the health effects such as those suggested in Table 2 (if any, are revealed by adapted studies, such as Safotests or Toxotests), could only be due to two possibilities: Firstly, the side effects may be directly or indirectly due to a pesticide residue and/or its metabolites.

Environmental Sciences Europe

Additionally, as previously underlined, future experiments should focus on the relevance of DNA resection in the formation of HR centers.

BioEssays

As previously underlined, the CD is the only region of CX3CL1 that binds to the receptor (Fong et al., 1998; Mizoue et al., 2001).

Biology Open

As previously underlined (Tibshirani and Efron, 2002; Truntzer et al., 2008), combining genes and classical clinical variables tends to give biased results.

Bioinformatics

The achievement of optimal DHA levels in formula fed infants could also be associated with improved neurocognitive and visual functions, as previously underlined by other studies [ 25- 27].

BMC Pediatrics

As previously underlined, the diarrhoea seemed unrelated to postnatal starvation, bot intrauterine events may have affected the normal development of intestinal absorptive capacity.

BMC Veterinary Research

Human-verified similar examples from authoritative sources

Similar Expressions

50 human-written examples

The characteristics previously underlined involve the presence of the maximum level of transport demand, as origin or destination, in the zone 3 inside the GRA.

European Transport Research Review

Officials say that Osborne's decision to abandon the conference to go to Luxembourg himself, rather than send Mark Hoban, the financial secretary, as previously planned, underlines how critically the government views the issue.

The Guardian - Business

Rinse and dry as previously explained.

WikiHow

58, 59 As underlined previously, IPC was first identified in the heart and successively in the brain.

Clinical interventions in aging

As a control, a mutated version of this promoter was synthesized (Medigenomics) to contain four point mutations in each SRE element as previously reported [49] (AAAAGAACCCCTATGCAAACTCCTCCCCCTGC, mutations underlined).

Plosone

Expert writing Tips

Best practice

Use "as previously underlined" to effectively guide the reader back to a key point, reinforcing its importance in the current context. Avoid overuse to maintain impact.

Common error

Don't use "as previously underlined" for points that were only tangentially mentioned or lacked significant emphasis earlier. It creates a false sense of importance and weakens your argument.

Linguistic Context

The phrase "as previously underlined" functions as an adverbial phrase. It modifies a clause by indicating that the information being presented has been emphasized or highlighted earlier in the text. As Ludwig AI shows, it connects current statements with prior points, reinforcing their importance.

Expression frequency: Uncommon

Frequent in

Science

80%

News & Media

10%

Wiki

10%

Less common in

Formal & Business

0%

Encyclopedias

0%

Reference

0%

Ludwig's WRAP-UP

In summary, "as previously underlined" is a useful phrase for referring back to and reinforcing key points in writing. As Ludwig AI confirms, the phrase is grammatically correct and appears most commonly in science and academic contexts. When using it, ensure that the point was indeed previously emphasized to avoid diluting its impact. Alternatives like "as previously highlighted" or "as previously noted" can be considered for subtle variations in emphasis. The phrase is generally formal and scientific, but appears in News & Media and Wiki as well. Considering usage patterns, you can use the phrase in formal or scientific context without worrying about sounding out of context. Do not overuse.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

as previously emphasized

Replaces "underlined" with a more general term for highlighting.

as previously highlighted

Similar to emphasized, but suggests a visual highlighting.

as previously noted

A more neutral way of indicating a prior mention.

as mentioned before

Informal and direct way of referencing prior information.

as stated earlier

Focuses on the act of stating something previously.

as we've already pointed out

Emphasizes the speaker's or writer's role in highlighting the point.

to reiterate a previous point

Formal and clearly indicates a repetition of an idea.

as we've seen

Highlights a conclusion or fact that has emerged from prior evidence.

returning to an earlier emphasis

Highlights that it is an earlier point, but more words.

recalling a previous highlight

Focuses on the act of calling something back into memory that was previously emphasized.

FAQs

How can I use "as previously underlined" in a sentence?

Use "as previously underlined" to refer back to an idea or argument that you want to reinforce. For example: "The importance of data privacy, as previously underlined, cannot be overstated."

What are some alternatives to "as previously underlined"?

You can use alternatives like "as previously emphasized", "as previously highlighted", or "as previously noted" depending on the context.

Is it redundant to use "as previously underlined" if the point is already clear?

Yes, using "as previously underlined" can be redundant if the point is already clear and well-understood by the reader. It's best to use it sparingly to reinforce key arguments.

What is the difference between "as previously underlined" and "as previously described"?

"As previously underlined" emphasizes a point or argument, while "as previously described" refers to details or information that were provided earlier. Choose the phrase that best reflects what you are referencing.