Sentence examples for as describe elsewhere from inspiring English sources

MCF-7 cells were stably transfected with empty pcDNA3 (MP cells) or pcDNA3 containing sense Arl2 (MA+ cells) or antisense Arl2 (MA- cells) as describe elsewhere [20].

Genomic qPCR was performed using the ViiA7™ real-time PCR system (Life Technologies, Carlsbad, CA) as describe elsewhere [ 31].

The culture was rescued using either M13KO7 or KM13 helper phage (MRC HGMP Resource Centre, Cambridge, UK) as describe elsewhere [ 55].

All putative secreted sequences were merged in a single FASTA file and submitted to the CD-HIT server [ 68] for hierarchical clustering (H-CD-HIT) as describe elsewhere [ 69].

To amplify exon 6, we used the following primers: forward, GGGTTTTCGATTGCTGTCATT; reverse, AGTCAGCAGCACTCCTCCAT. To amplify exon 7, we used the following primers: forward, ATTTAGCTGCTGAGGCTGGA; reverse, GACAAAGACCCGAGAAGCAC. Mitochondrial isolation was performed as describe elsewhere (Fernandez-Vizarra et al, 2002).

All qPCR experiments were triplicate and the copy number of each target was defined as 2-ΔΔCT, where ΔCt is the difference in threshold cycles of the sample in question normalized against the reference region and expressed relative to the value obtained by calibrator DNA (individual/calibrator) as describe elsewhere [ 32].

Radiolabeling was performed as described elsewhere [9].

Liposomes were prepared as described elsewhere [24].

CPR was performed as described elsewhere [4].

The global WR was calculated as described elsewhere [13].

AdR was heterologously expressed and purified as described elsewhere [24].