Sentence examples for as bcv from inspiring English sources

To quantify the relative impact of potential risk factors for a herd to be detected as BCV or BRSV-infected (e.g. trade intensity, density of dairy herds, herd size, biosecurity measures, type and number of visitors), studies could be conducted by comparing herd characteristics and management practices in the low and high-risk areas identified.

The constitution sets as the BCV's objectives price stability and the maintenance of the value of the currency.

Similar studies for BRSV and BCV have, as far as we know, not been conducted and it is therefore difficult to quantify their effect on the farm efficiency and economy.

This study compared the characteristic parameters of ocular vestibular-evoked myogenic potentials (oVEMPs) elicited by the air-conducted sound (ACS) and bone-conducted vibration (BCV) stimulation modes as well as the galvanic vestibular stimulation (GVS) mode.

And finally, the data suggest that the therapeutic window for efficacious BCV treatment decreases as the virus infectious dose increases.

Two plasmid clones containing 1 kb region of the rabies and BCV genomes served as error controls in the study.

Samples containing BCV RNA were identified as described in Cho et al. [ 36].

BCV has gained ground as a pathogen in respiratory disease complex recently [ 25, 11, 26].

In addition, the paired serum samples were tested for antibodies against BCV and PI-3 as previously described [ 21].

The inserts were generated by RT-PCR as described above using rabies and BCV polymerase primers: RVpolyF1 5' CCCCTGACTCCTTATATCAAAACC, RVpolyR1 5' GCGAGGTTGACTATTTGGTC, BCVpolyF2 5' TTTGCAGACAAATTGGTGGA, and BCVpolyR2 5'GGCGTAAATTTCATCCTGCT.

Further confirmation is needed regarding problems such as the criteria to start and terminate BCV.