Sentence examples for as a standard protocol from inspiring English sources

He is in good condition and will be at bed rest for the remainder of the day as a standard protocol in procedures such as this.

Even so, "as a standard protocol, he pointed it in a safe direction at a concrete wall," the commission said.

Many additional benefits of MGIL to formation evaluation have also been recognized, and it is envisaged MGIL possesses the potential to develop as a standard protocol on drilling wells.

The PLC technology has been applied to the system, and as for the application, RUDP was used in its transfer layer as a standard protocol to compensate transmission loss often caused by the noise generation in a PLC system.

mosquitoes, and this was adopted as a standard protocol for further work.

Not all European HEMS services have a doctor-paramedic team as a standard protocol.

To assess BMD the proximal femur and lumbar spine (L2-L4) were measured as per a standard protocol provided to all sites.

Nevertheless the design included trustworthy methods such as using a standard protocol to introduce the study to prospective participants, selecting patients at different stages in the disease trajectory, using a topic schedule for interviews and recording interviews for transcription.

Lead estimates with uncertainty values > 10 μg/g for tibia and > 15 μg/g for patella were excluded as unreliable, a standard protocol in analyses of bone lead (Hu et al. 1998).

To detect the transgene, mice were subjected to the polymerase chain reaction (PCR) with CACGTAGGAGGATGGCGCAGGGCTAG and TAGCGGCTGAAGCACTGCA as primers, using a standard protocol as described on the MMMRRC website [ 27].

PCR were performed with 10 to 100 ng of genomic DNA as template following a standard protocol.