Sentence examples for as a standard protocol from inspiring English sources

Exact(18)

He is in good condition and will be at bed rest for the remainder of the day as a standard protocol in procedures such as this.

Even so, "as a standard protocol, he pointed it in a safe direction at a concrete wall," the commission said.

Many additional benefits of MGIL to formation evaluation have also been recognized, and it is envisaged MGIL possesses the potential to develop as a standard protocol on drilling wells.

The PLC technology has been applied to the system, and as for the application, RUDP was used in its transfer layer as a standard protocol to compensate transmission loss often caused by the noise generation in a PLC system.

mosquitoes, and this was adopted as a standard protocol for further work.

Not all European HEMS services have a doctor-paramedic team as a standard protocol.

Show more...

Similar(41)

To assess BMD the proximal femur and lumbar spine (L2-L4) were measured as per a standard protocol provided to all sites.

Nevertheless the design included trustworthy methods such as using a standard protocol to introduce the study to prospective participants, selecting patients at different stages in the disease trajectory, using a topic schedule for interviews and recording interviews for transcription.

Lead estimates with uncertainty values > 10 μg/g for tibia and > 15 μg/g for patella were excluded as unreliable, a standard protocol in analyses of bone lead (Hu et al. 1998).

To detect the transgene, mice were subjected to the polymerase chain reaction (PCR) with CACGTAGGAGGATGGCGCAGGGCTAG and TAGCGGCTGAAGCACTGCA as primers, using a standard protocol as described on the MMMRRC website [ 27].

PCR were performed with 10 to 100 ng of genomic DNA as template following a standard protocol.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: