Sentence examples for as a potential sequence from inspiring English sources

Exact(1)

For in silico SNP discovery, the rapidly growing public EST databases can be exploited as a potential sequence resource [ 24, 25].

Similar(59)

The use of a non-enzymatic fragmentation method and the specific enrichment for nucleosome-bound DNA by immunoprecipitation should rule out that nucleosome-sized fragments were obtained merely as a potential sequence-based artifact of MNase digestion.

Despite the fact that we used genomes at different stages of completeness, our conclusions are robust to the absence of annotation and assembly as well as potential sequencing errors.

To confirm this, we generated mutations at this sequence (CD44d-Mut, 5'ttggaagctctccacgttcag) as well as in the potential sequence (CD44c) creating CD44c-Mut (5'catggaagaccaagctcccgag) in the luciferase reporter vector (Figure 4C).

We used the information in the reference multiple alignment to build a model of the protein family and sequences that deviated from this model were annotated as having potential sequence errors.

However, as the detected potential sequence length biases do not make it impossible to obtain usable microsatellite loci, this drawback does not invalidate the process as a whole.

The best matching isolates were taken as potential sequence donors, and combined with the recipients and all complete publicly available genome sequences (although using only S. pneumoniae OXC141 as a representative of the CC180 clade; Croucher, Mitchell, et al. 2013) to represent the species-wide variation in the region flanking the cps locus.

RDP3 treats every sequence within the analyzed alignment as a potential recombinant, and systematically screens sequence triplets and/or quartets to identify sequences that contain a recombinant and two sequences that could serve as parents, and performs a statistical evaluation of recombination signal [28].

Hitchhiking with Y-linked sexually antagonistic alleles was investigated as a potential cause of inflated sequence diversity in regions experiencing strong Y linkage.

These findings provide a comprehensive coverage to discover many known genes of several major metabolic pathways substantially responsive to exogenous ABA signaling, which also serve as a potential contribution to available sequence resources for castor bean.

The Ti/Tv ratio has been used as an indicator of potential sequencing errors, and it has been empirically approximated to around 2.1 and 2.2 in recent resequencing studies in Humans and cattle, respectively.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: