Your English writing platform
Free sign upSuggestions(2)
The phrase "as a normalizing condition for the" is correct and usable in written English.
It can be used in contexts discussing standards, frameworks, or criteria that establish norms or benchmarks in various fields such as sociology, psychology, or data analysis.
Example: "The study aims to identify the factors that serve as a normalizing condition for the behavior of individuals in group settings."
Alternatives: "as a standardizing factor for the" or "as a regulating condition for the".
Exact(1)
Wang and Liebau's explanation of the failure of the valence sum rule is not convincing and is not compatible with the use of the valence sum rule as a normalizing condition for the bond valences.
Similar(59)
With respect to assessing individual abilities, the incorporation of adaptive mechanics acts as a normalizing agent for each individual in accordance with their underlying cognitive abilities,18 facilitating fair comparisons between groups (for example, neurotypical and study populations).
It's going to be a normalizing constant for the equation.
n = 4 rats for each group To further validate the use of cell number as a normalizing factor, the protein/cell and DNA/cell were divided.
After that, a normalizing criterion (7) for the route as a whole is being found with further classification of images into good and bad according to ratio (8).
Using the normalizing condition below, it follows that sumlimits_{i = 0}^{3} {P_{i} (infty ) = 1} (3.5).
ΔΔCt values were calculated using miRNA-142 as a normalizing control (miScript Primer Assays for Mm_miR-142-5p_1 targeting CAUAAAGUAGAAAGCACUACU, from Qiagen) based on a published report [ 8].
Solving Eq. (3.25) and using normalizing condition sumlimits_{i = 0}^{6} {P_{i} (infty )} = 1.
Ct values for α-tubulin expression served as a normalizing signal.
The GAPDH gene was used as a normalizing control.
100 ng of cDNA was used for the 25 µl PCR reaction, and GAPDH was used as a normalizing control.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com