Sentence examples for as a normalising control from inspiring English sources

cDNAs were assayed in triplicate and levels of 18S rRNA was used as a normalising control.

In addition, there is no consensus on suitable small RNA reference genes that could be used as internal controls for biological variability; current protocols call for samples to be processed from identical input volumes, then corrected for technical variability using spiked-in synthetic non-human (Caenorhabditis elegans) miRNA as a normalising control (Mitchell et al, 2008; Kroh et al, 2010).

Macri said more job losses were likely in what he described on several occasions as a "normalising" of the economy.

A hemiallelic strain containing the empty YCplac111 vector as well as the vector carrying the wild type MIP1 (vector /MIP1) was also used as a control to normalise the allele dosage and differentiate between antimorphy and haploinsufficiency.

The house-keeping gene GAPDH (Forward primer 5′ ATGTTCGTCATGGGTGTGAA 3′; reverse primer 5′GTCTTCTGGGTGGCAGTGAT 3′) was used as a control to normalise the data, as the cycle threshold value for GAPDH expression was consistent across the sample set.

Rat 18S rRNA was used as an internal control for normalising relative expression levels in the different samples.

The second set of tumours was analysed for phospho-ERK1/2, phospho-AKT and PTEN expression by Western blot also normalised by Raf as a loading control.

GAPDH was used as an internal control to normalise the relative amount of cDNA in each reaction.

The housekeeping gene GAPDH was used as an internal control to normalise the variable expression levels of Pyk2.

The 18S ribosomal RNA gene was used as an endogenous control to normalise RNA amounts in each sample.

The values of β-actin mRNA were used as an endogenous control to normalise for differences in the amount of total RNA.