Sentence examples for as a detection instrument from inspiring English sources

Despite the fact that the WRFQ is to be used as a detection instrument to identify, and not value decreased productivity, it can serve as an excellent example since several studies have translated and adapted the WRFQ to Canadian French [ 45], Brazilian Portuguese [ 46], Dutch [ 47], and Spanish [ 48].

Conducting a diagnostic accuracy study on a child abuse detection instrument is also accompanied by scientific hurdles, such as the lack of an accepted reference standard and potential (non-) response.

However, conducting a study on diagnostic accuracy of a child abuse detection instrument is accompanied by several scientific hurdles, such as the lack of an accepted reference standard.

Detection of IR mRNA level was carried out in a Bio-Rad detection instrument using SYBR Green reagent (Qiagen) with the following primers: forward: 5'- CACCAATACGTCATTCACAAC -3' and reverse: 5'- AGGATTTGGCAGACCTTAGG -3'.

In the Netherlands, a child abuse detection instrument called SPUTOVAMO has been widely introduced at ER's.

Fluorescent endpoints of the TaqMan reactions were measured using a 7900HT sequence detection instrument.

The endocytosis of Stx was measured and quantified by an electro-chemiluminescent detection instrument (BioVeris Corporation, Gaithersburgh, MD, USA) as described in detail previously [27].

Therefore, an automated multianalyte detection instrument is needed quantifying simultaneously antibiotics within some minutes.

The assays were analyzed on a Tecan Safire® detection instrument.

Real-time PCR reactions in 384 well plates utilized an ABI Prism 7900HT Sequence Detection instrument from Applied Biosystems.

This detection instrument makes embedded ARM9 as its center.