Sentence examples for arn samples from inspiring English sources

Full length cDNA of PpHsp16.4, lacking the stop codon, was PCR amplified from total ARN samples extracted from P. patens treated with 50 μM ABA for 24 hours, using the following primers: forward "gtggatccttggtcaacttgagag" and reverse "atatctcgagtgctttccccccatagtcac".

PCR on aqueous humor sample allowed identification of the causative agent in ARN from 40%[16]toto 86.4% [5] and these results were similar to our findings.

While, HCV-ARN was detected in 53 out of 216 anti-HCv positive samples (24.54%) and HIV-RNA in 52 out of 78 anti-HIV positive samples (66.67%).

RIP, Arn.

Arn Strasser Portland, Ore.

"Answer it, Arn," she said.

I told Arn we have to get it done".

Kazuo Matsui and Hideki Matsui share the same agent, Arn Tellem.

She did not play to her status against Arn.

KROLL--Arnold (Arn) H.,passed away on Tuesday, September 27, 2011 at age 76 in Orleans, MA.

Friday in New York, Arn Tellem was in his backyard in Los Angeles, hosting a cookout.