Your English writing platform
Discover LudwigSuggestions(2)
The phrase "arm location" is correct and usable in written English.
It can be used in contexts related to anatomy, medical discussions, or when specifying the position of an arm in various scenarios.
Example: "The doctor noted the arm location for the injection site during the examination."
Alternatives: "position of the arm" or "arm position".
Exact(14)
The purpose of the study was to determine if forearm blood pressures (BPs) measured in three different locations agree with the recommended upper arm location for noninvasive BP measurement.
However, there was some discrepancy in the 4B arm location for these ESTs.
The goal arm location for sequential mice was different to avoid odor cues from revealing the goal arm.
Chromosome arm location was confirmed by BLASTn analysis of flow-sorted wheat chromosome arm sequence data (Table 2).
We developed GPC-A2-specific primers (Forward = 5'–CACCCACCAGCTAGAAGCTC–3', reverse = 5'–andconfirmedGtheTGTG–3') and confirmed the 2AS chromosome arm location using the IWGSC genomic sequence database (IWGSC_CSS_2AS_scaff_5260301).
To express BAC location in micrometers, the percentage of the arm location was multiplied by the average length of the SC arm (Sherman and Stack 1992; Peterson et al. 1996; Chang et al. 2007).
Similar(46)
The 3B arm locations in our study were determined by locating the genes that were identified in the 3B shotgun sequence to the reference genome.
This position was used in determining arm locations of genes on this chromosome.
Individual resulting colonies were screened by PCR for appropriate recombination at both homology arm locations.
The arm locations of genes on chromosome 3B were also identified previously [ 22].
Although we identified a large number of markers in our study with arm locations 3AS/3BL/3DS (55 genes) and 3AL/3BS/3DL (94 genes), it seemed unlikely that these nonstandard arm locations were caused by a pericentromeric inversion.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com