Sentence examples for arm downstream from inspiring English sources

Suggestions(1)

Exact(2)

Therefore we asked what happens if we interfere with the fusion machinery arm downstream of Rab27 with anti-Rab3A antibodies as inhibitor 1. BAPTA-AM used as inhibitor X prevented the AR.

The recent report that KRAS-induced pancreatic cancer was substantially reduced in mice expressing an S6 mutant that could not be phosphorylated also highlighted the importance of this signalling arm downstream of mTOR.

Similar(58)

Taken together, our results indicate that there is a connection between the calcium mobilization and protein machinery arms downstream of Rab3 and upstream of PTP1B.

However, the reduction in both Smad and p38/Jnk/Erk MAP kinase responses in Tak1col2 chondrocytes indicates that TAK1 has an important but distinct function in both signalling arms downstream of BMP2/7.

In all cases the left arm extends downstream till the beginning of the predicted PPT, which occupies the 5' border of the loop sequence.

Interestingly, c587-mediated arm* expression can fully rescue the germ cell differentiation defect caused by the two independent dshRNAi knockdowns, indicating that Arm functions downstream of Dsh in ISCs to promote germ cell differentiation.

But Exxon's downstream arm, which includes its refining and marketing operations, posted profits of $37 million, well off the $1.1 billion it earned a year ago.

The primers GGGCCGCGTAAACTGGCCTTGAGGTGAGACCAGTGG and GGGGCGGCCGCGAGTGCTGGGATTAAAGGCGTGCGCCACC were used to clone the downstream arm of homology between the XbaI and NotI sites.

The short arm of homology downstream of the first exon of Lrp4 was generated by PCR amplification using the primers MEJ33 (5'-CTCGAGGAGCGGTCTGCAGATCCTGGCGATTCACGG-3') and MEJ35 (5'-CTCGAGGGTTACAGACTCTGCAACTGCTCTACCTCATTG-3').

In this study, we identify a functional interplay between HER2 and its interactor Grb7 whereby HER2 signaling represses Grb7 using the PI3K-Akt arm of its downstream signaling cascades.

The short arm of homology downstream of the first exon of Lrp4 was generated by PCR amplification using the primers MEJ33 (5′-CTCGAGGAGCGGTCTGCAGATCCTGGCGATTCACGG-3′) and MEJ35 (5′-CTCGAGGGTTACAGACTCTGCAACTGCTCTACCTCATTG-3′).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: