Sentence examples for are underlined as from inspiring English sources

EMSAs were performed based on a previously established protocol [46] using an oligonucleotide encompassing the Stat-binding site of the mouse Cdkn1b promoter in wild type form (5'-TTAATTTCCTGTAACATG-3') or in its mutant form (5'- TTAATTGTCTGCGACATG-3'; mutations are underlined) as reported [18].

An hypothetical alteration of brain 5-HT neurotransminsion in migraine patients, probably genetically determined, was repeatedly searched in the periphery (platelets, vessels, etc)., and sex and seasons were underlined as critical variables in the interpretation of diagnostic group differences [1, 10].

The residues mutated and the substitutions are underlined in bold.

(These are underlined in the pop-up window).

In the examples words that are underlined are aligned to each other and words that are strikethrough are marked as deleted.

Both elements are interesting; both are underlined way too heavily.

Mutated positions in the sequence are underlined [ 17].

The word "not" was underlined, for good measure.

The combination of pepper spray, Swat teams and judicial torture – for that is what it was – underlined for me a strain of American life that is forever present but rarely makes itself so boldly visible as it has this week.

If the text after that is seen underlined as well, then you did not type the closing tag correctly.

Domain V (747 nt) of the Drosophila 28S ribosomal RNA was produced using in vitro transcription (Fermentas, Germany) and a PCR fragment amplified with primers 5′ TAATACGACTCACTATAGGGGATATTAGACCTCGGTTTGGTATCG (T7 promoter sequence is underlined) and 5′TGTGCCATTGGTCCGTACCTGCGGG, as a template.