Sentence examples for are underlined as from inspiring English sources

Suggestions(1)

The phrase "are underlined as" is correct and usable in written English.
It can be used when referring to text that has been emphasized or highlighted in a specific way, such as underlining, to indicate its importance or to draw attention to it.
Example: "The key terms in the document are underlined as a way to highlight their significance for the reader."
Alternatives: "are emphasized as" or "are marked as".

Exact(1)

EMSAs were performed based on a previously established protocol [46] using an oligonucleotide encompassing the Stat-binding site of the mouse Cdkn1b promoter in wild type form (5'-TTAATTTCCTGTAACATG-3') or in its mutant form (5'- TTAATTGTCTGCGACATG-3'; mutations are underlined) as reported [18].

Similar(59)

An hypothetical alteration of brain 5-HT neurotransminsion in migraine patients, probably genetically determined, was repeatedly searched in the periphery (platelets, vessels, etc)., and sex and seasons were underlined as critical variables in the interpretation of diagnostic group differences [1, 10].

The residues mutated and the substitutions are underlined in bold.

(These are underlined in the pop-up window).

In the examples words that are underlined are aligned to each other and words that are strikethrough are marked as deleted.

Both elements are interesting; both are underlined way too heavily.

Mutated positions in the sequence are underlined [ 17].

The word "not" was underlined, for good measure.

The combination of pepper spray, Swat teams and judicial torture – for that is what it was underlined for me a strain of American life that is forever present but rarely makes itself so boldly visible as it has this week.

If the text after that is seen underlined as well, then you did not type the closing tag correctly.

Domain V (747 nt) of the Drosophila 28S ribosomal RNA was produced using in vitro transcription (Fermentas, Germany) and a PCR fragment amplified with primers 5′ TAATACGACTCACTATAGGGGATATTAGACCTCGGTTTGGTATCG (T7 promoter sequence is underlined) and 5′TGTGCCATTGGTCCGTACCTGCGGG, as a template.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: