Sentence examples for are standardised with from inspiring English sources

Exact(3)

Indices are standardised with a mean of 0 and a standard deviation of 1.

The scores for BFI-S and Grit-S subscales are standardised with a mean of zero and a standard deviation of one.

As is generally done in the literature (Husain and Millimet 2009; Fryer and Levitt 2010; Sohn 2012; Golsteyn and Schils 2014), NAPLAN test scores are standardised (with mean 0 and standard deviation 1) by grade and domain in this paper.

Similar(57)

In an 'A' grade 100-mL volumetric flask, 100.0361 mg of chromium (III) chloride was dissolved thoroughly and the resultant solution was standardised with EDTA.

"Once you take away all the colour coding and imagery and everything is standardised with massive health warnings, you really do de-glamorise the product".

Hence, the monitoring of ecological effects of GMO must be standardised with regard to parameters, methods, survey intervals and sites so that data are comparable in terms of measurement methods and, thus, can be analysed statistically and interpreted meaningfully [22].

Results were standardised with cane toad actin (GenBank Accession no. EL595572) by amplifying a 117 bp fragment using sense 5'- ATGACACAGATAATGTTTGAGAC -3' and antisense 5'- ATCACCAGAGTCCATCACAAT -3' primers.

All observations were standardised with respect to observation time.

The values of VEGF were standardised with cell number.

Surgical and anaesthetic techniques were standardised, with all patients undergoing spinal anaesthesia.

The levels of VEGF-C were standardised with the corresponding cellular protein concentrations.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: