Your English writing platform
Free sign upExact(1)
Different from conventional approaches, two dedicated designed thresholds are set to amplify the small signals and compress the large signals, respectively.
Similar(59)
Both amplifiers on mfERG1 were set to amplify 100,000 times.
The PCR program was set to amplify multimers and the amplification products showed a clear organization of Tcast2a in tandem repeats (fig. 1 b).
All chimeric T6 g38 were amplified using the FT6.80.11/FR81 primer set to amplify the entire g38 sequence.
Lastly, a multiplex PCR containing the four sets of primers was set up to amplify all four targeted viruses in one reaction.
PCR reactions were set up to amplify VH and VL regions with a mix of IgG- and Igk/λ specific primers, respectively.
PCR reactions were set up to amplify bacterial DNA using the primer 5'TGAAGAGTTTGATCATGGCTCAG combined with either primer 5'AAGGAGGTGATCCAACCG, 5'TCGTTGCGGGACTTAACC or 5'TACCGCGGCTGCTGGCA.
25 μL PCR reactions were set up to amplify each INDEL of interest using K8101-49685s' genomic DNA as template and LongAmp Taq DNA polymerase (New England Biolabs).
For the first step, two standard PCR reactions were set up to amplify the 500-nucleotide (nt) regions immediately upstream (or downstream) of the target gene, with genomic K. lactis CK11 or S. kluyveri CBS 3082 DNA as a template.
A eukaryote-specific 18SF/28SR primer set was used to amplify ITS1, ITS2 and 5.8S genes [ 47].
For each sample, LNA control primer set was used to amplify UniSp6 spike-in positive control.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com