The phrase "are probing forward" is correct and usable in written English.
It can be used to describe the action of investigating or exploring something in a progressive manner.
Example: "The researchers are probing forward into the complexities of the human genome to uncover new insights."
Alternatives: "are advancing" or "are delving deeper".
Whereas the rise of the transient absorption signals of the product states are probing the forward electron injection reaction their decay does not simply probe the recombination reaction to the ground state dye and is complicated due to several additional effects.
The only thing is he is looking to hurt his rival with every shot and is maybe neglecting his boxing". Hidenori Otake is not shy about coming forward, but Scott Quigg is probing away at the body and getting plenty of joy.
In half of these 16 triplets memory was probed in a forward direction, starting with the first word 'A' and requiring the subject to type in the following B word (referred to as 1st or AB transition), and then presenting the second word 'B' and asking for the C word (referred to as 2nd or BC transition).
Since at learning only forward recall was probed, percentages were calculated for both forward and backward retrieval with reference to the respective 1st and 2nd transitions of forward recall at learning.
After generations of being an adventurous, exploratory music always probing forward -- an avant-garde art of the American street -- jazz flipped backward, focusing on its past.
Because at learning only forward recall was probed, the calculation of the percentages for backward retrieval was based on the performance for the respective forward transition at the test of learning.
Specific primers and probes are: primer forward mFGF-2 5'CACCAGGCCACTTCAAGGA3', primer reverse mFGF-2 5' GATGGATGCGCAGGAAGAA3'.
Primers and probe are as follows: Forward- 5'-GTA ATT GGA ATG ATA GGA ATT TAC AAG GT-3', Reverse- 5'-TCA-ACT-ACG-AAC-GTT-TTA-ACT-GCA-AC-3', Taqman probe- TGC-CAG-CAG-CCG-CGG-TAA-TTC (FAM and TAMRA labeled).
To address the frequency of the sequence variant g.7876A>G (Y93C) in a normal population, the following primers and probe were designed: forward primer 5'GGCTGCTTATTTGAATCCTTGCT3', reverse primer 5'andTGCCAGTGACCATGAAGAGT3' and MGB probe variant allele 5'ATGGACTgTTCCCTG3' labelled with VIC.
The primers and probe sequences are: Forward primer: GCGCCAAGATCCATTCGTT; Reverse primer: GAACATGAACTTGTGCCGGTT; TAQMAN Probe: CCATGGCCGACACC.
