Sentence examples for archiving product from inspiring English sources

And in February, Microsoft said it was integrating an archiving product from IMlogic, in Boston, into its next-generation Windows messaging software.

The museum is organized into six curatorial departments: archives; product design and decorative arts; drawings, prints, and graphic design; textiles; wall coverings; and digital.

About the same time, FaceTime came out with its archiving and monitoring product, and Ms. Housley decided it was safe to permit instant messaging as long as it could be logged.

cDNA synthesis was carried out using a high capacity cDNA archive kit (Applied Biosystems, Product Number 4322171) according to the manufacturer's protocols.

Forward 5' TGCATCTGCCTCCCCATATT 3' Reverse 5' AGTGGGCGGGCAATGTAG Probe CTCGGACACCACACCCTGCTGCTGCTGCT 3' For quantification of mRNAs by LDA, cDNA was synthesised from RNA obtained from liver, tonsil and thrombin-treated aortic endothelial cells using a high capacity cDNA archive kit (Applied Biosystems, Product Number 4322171) according to the manufacturer's protocols.

Like so many other things related to the Grateful Dead, though, the archive is largely the product of happenstance, not design.

The archive of these products began in 1993.

We also examined trace archive and PCR-product derived sequence data from eight New World monkey species.

ESA will provide all data products through the archiving and dissemination infrastructure of the Swarm mission.

The zonal and meridional winds are obtained at regular longitude-latitude grids in the pipeline and will be archived as a level-3 product in the NetCDF format together with the gridded image data.

In January 2007, as the onetime Massachusetts governor was leaving office -- and preparing for his first presidential run -- he and his staff were required by law to transfer much of their work product to state archives.