Sentence examples for appropriate vector from inspiring English sources

The appropriate vector loops are selected automatically at runtime with no recompilation required.

However, for efficient delivery of gene materials, designing an appropriate vector is necessary.

Then the probability that choosing an appropriate vector such that satisfies (8) is at most.

Albumin has several unique features that make it an appropriate vector for targeted drug delivery in oncology.

In convex models and interval analysis models, the uncertain quantities are considered to be unknown except that they belong to given sets in an appropriate vector space.

The equations of RFD can be written as a hyperbolic system of conservation laws by choosing an appropriate vector of unknowns.

We examine appropriate vectors, safety issues, and rates of bone formation.

Optimized immunogens can subsequently be presented to the immune system with appropriate vectors allowing to target professional antigen-presenting cells, such as dendritic cells.

Through consideration of a refined set of bound fragments, in the context of the compounds from which they originated, appropriate vectors for appended R-groups can be assigned before validation of the final library.

The results indicate that FPV recombinants can express correctly the E6 and E7 oncoproteins, and they should represent appropriate vectors for the expression of these oncoproteins in human cells.

The final constructs were verified by DNA sequencing on an ABI Prism 3730_L sequencer (Seq- Wright, Houston, TX) with appropriate vector-specific T7 (F: TAATACGACTCACTATAGGG) and pAE (R CAGCAGCCAACTCAGTTCCT) primers.