Sentence examples for appropriate following from inspiring English sources

Exact(17)

We will have further comment, if appropriate, following next week's policy board meeting".

It seems more appropriate following the newest Sharknado movie rather than reruns of Scorpion and 2 Broke Girls.

The Justice Department said Friday that Holder considered a preliminary review appropriate following a recommendation from the Office of Professional Responsibility and other information.

This template DNA was co-transformed into BY4741 along with linear fragments encoding Cas9 and a gRNA retargeted to either UBP3 (CTTAACGCAATCGAACCCAG) or MXR1 (CCACAAACTCTCTTATAAGA) as appropriate, following the protocol described at http://benchling.com/pub/ellis-crispr-tools.

The Virgin policy, written by the company's emergency planning, fire and security manager, Jim Rawcliffe, adds: "Any such decision to release footage for these purposes will be approved by the head of safety and environment and, where appropriate, following consultation with the relevant police authority".

Pharmacists, he says, have to make sure the treatment is appropriate, following a consultation similar to one carried out by a GP.

Show more...

Similar(43)

The NAO fluorescent signal of energized mitochondria was collected in the appropriate channel following staining.

These EAs can be measured in air-dried soil with appropriate substrates following similar assay conditions.

So it's appropriate that, following Hodgson's presentation, Weschler is scheduled to discuss apophenia (the human tendency to see patterns where there are no patterns).

An appropriate flourish following the radical reform of business rates – and Manchester couldn't be a better setting for the announcement.

Sergio Ermotti, chief executive of UBS, said the group had "taken decisive and appropriate actions" following the probe.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: