Sentence examples for approaches we added from inspiring English sources

Suggestions(1)

Exact(2)

To the summary statistic approaches we added the coalescence-based maximum-likelihood method of Galtier et al. [ 16].

In order to make the SASI fragment design applicable to Nextera library preparation and PCR-based enrichment approaches, we added the sequences TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG and GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG, that are normally introduced via the Nextera reaction [ 33], to the respective 5' ends of forward and reverse primers used in SASI fragment generation.

Similar(58)

In the pattern-based approach, we added a third phase in the service creation process, which is aimed at the compilation of the service to generate the final service code.

I thought it was worth revisiting, and just to give it a slightly fresh approach, we added a few orchestral sections and a modulation.

In the first approach we added to the binary feature vector coding the given sequence for the SVM the description of its location in sequence space.

For the computational approach, we added custom-designed filters based on known characteristics of insect miRNAs in addition to software tools, such as Srnaloop [48].

Following our system-theoretic approach, we added a third aspect.

In a novel approach, we added different concentrations of glucose (repressor) to the medium and analysed its impact on recombinant protein produced.

To determine the best pipeline approach, we added all distances (positive and negative) in both spaces and the pipeline with the largest positive distance from random is deemed the best (see Additional file 1: Table S 1, Tab "Overall").

As an alternative approach, we added one sky observation to bins in cases without sky observation to calculate relative CHP for bins of 2 and 10 m length and confirmed that similar results were obtained (Supplementary Data Fig. S2).

Using a stepwise model building approach, we added the following groups of variables separately into an adjusted model: socio-demographic variables, comorbidities, and factors related to the index hospitalization and post discharge care.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: